control scrambled shrna cassette  (OriGene)

Journal: Cells

Article Title: PDCD10 Is a Key Player in TMZ-Resistance and Tumor Cell Regrowth: Insights into Its Underlying Mechanism in Glioblastoma Cells

doi: 10.3390/cells13171442

Figure Lengend Snippet: Knockdown of PDCD10 confers TMZ-resistance on GBM cells. ( A ) Confirmation of PDCD10 knockdown in lentiviral transduced U87 and T98g cells by RT 2 -PCR ( a ), western blot ( b ), and semi-quantitation of the blots ( c ). ev and sh: empty vector- and PDCD10 shRNA-transduced cells, respectively. IOD: integrated optical density. *, p < 0.05; **, p < 0.01; ***, p < 0.001, compared with ev. ( B ) Knockdown of PDCD10 in GBM cells leads to a resistance to TMZ-induced cell death. U87 and T98g cells received the treatment with 150 µM ( a ) and 300 µM ( b ) of TMZ, respectively, for 72 h. Thereafter, TMZ was washed-out. Remaining viable cells were cultured in the TMZ-free medium for 3 d, which is defined as the post-treatment phase. Control cells (C) were treated with vehicle DMSO (0.1% and 0.2% for U87 and T98g, respectively). MTT assay was performed to determine the viability of cells at 72 h after TMZ treatment (treatment phase) and 3 d after washing-out of TMZ (post-treatment phase). *, p < 0.05; **, p < 0.01; ***, p < 0.001, compared with ev; ##, p < 0.01; ###, p < 0.0001, compared with evC in the same phase; +++, p < 0.001, compared with corresponding group in treatment phase.

Article Snippet: Empty vector transduced cells in U87 (evU87) (Thermo Scientific, Waltham, MA, USA, cat# RHS4750) and T98g (evT98g) (OriGene, Rockville, MD, USA, cat# TR30021) served as controls.

Techniques: Knockdown, Western Blot, Quantitation Assay, Plasmid Preparation, shRNA, Cell Culture, Control, MTT Assay

Journal: Cells

Article Title: PDCD10 Is a Key Player in TMZ-Resistance and Tumor Cell Regrowth: Insights into Its Underlying Mechanism in Glioblastoma Cells

doi: 10.3390/cells13171442

Figure Lengend Snippet: Knockdown of PDCD10 enhances cell viability after rechallenge with TMZ in regrown cells (RG) generated from the established acquired TMZ-resistant model. ( A ) Confirmation of PDCD10 knockdown in shU87-RG and shT98g-RG cells by RT 2 -PCR ( a ) and by FACS of respective transduced cells that expressed red-fluorescence protein (RFP) and green-fluorescence protein (GFP) ( b ). *, p < 0.05, compared with ev. ( B ) MTT assay in RG cells in treatment phase and post-treatment phase. MTT assay was performed with ev/shU87 and ev/shT98g cells that received the treatment with 150 µM ( a ) and 300 µM ( b ) of TMZ, respectively, for 72 h (treatment phase) and 2 d and 4 d after washing-out TMZ (post-treatment phase, without reseeding). Control cells (C) received vehicle DMSO (0.1% and 0.2% for U87 and T98g, respectively). *, p < 0.05; ***, p < 0.001, compared with evRG C (72 h); ###, p < 0.001, compared with evRG-TMZ (72 h). ( C ) MTT assay in RG cells in a second post-treatment model with reseeding. ev/shU87-RG and ev/shT98g-RG cells received the treatment with 150 µM ( a ) and 300 µM ( b ) of TMZ, respectively, for 72 h. Thereafter, TMZ–containing media and dead cells were washed-out, and the viable cells were harvested and reseeded at the same density, followed by 2, 4, and 6 d of culture in drug-free medium. A significantly more rapid regrowth was observed in both TMZ-treated shU87-RG and shT98g-RG cells, compared with the corresponding evRG cells after reseeding and culturing in drug-free media. *, p < 0.05; ***, p < 0.001, compared with corresponding evRG.

Article Snippet: Empty vector transduced cells in U87 (evU87) (Thermo Scientific, Waltham, MA, USA, cat# RHS4750) and T98g (evT98g) (OriGene, Rockville, MD, USA, cat# TR30021) served as controls.

Techniques: Knockdown, Generated, Fluorescence, MTT Assay, Control

Journal: Cells

Article Title: PDCD10 Is a Key Player in TMZ-Resistance and Tumor Cell Regrowth: Insights into Its Underlying Mechanism in Glioblastoma Cells

doi: 10.3390/cells13171442

Figure Lengend Snippet: Overexpression of PDCD10 sensitizes GBM cells to TMZ treatment. ( A ) Confirmation of overexpression of PDCD10 in lentiviral transduced U87 and T98g cells by RT 2 -PCR ( a ) and western blot ( b ) and semi-quantitation of the blots ( c ). Western blotting with anti-V5 antibody distinguishes between the expression of transgenic C-terminal V5-tagged PDCD10 protein and endogenous protein. ev and ox: empty vector-transduced and PDCD10-overexpressing cells, respectively. IOD: integrated optical density. *, p < 0.05; **, p < 0.01; ***, p < 0.001, compared with ev. ( B ) Overexpression of PDCD10 significantly reduces cell viability in a concentration-dependent manner after 72 h of TMZ treatment in both oxU87 ( a ) and oxT98g ( b ) cells. Control cells (C) were treated with vehicle DMSO (0.1% and 0.2% for U87 and T98g, respectively). *, p < 0.05; **, p < 0.01; ***, p < 0.001, compared with corresponding ev groups. ( C ) Overexpression of PDCD10 sensitizes GBM cells to TMZ treatment 72 h after TMZ treatment (treatment phase) and 3 d after washing-out TMZ (post-treatment phase). ev/oxU87 and ev/oxT98g cells received the treatment with 150 µM ( a ) and 300 µM ( b ) of TMZ for 72 h, respectively. Thereafter, TMZ-containing medium and dead cells were washed-out and the viable cells were further cultured in drug-free medium for 3 d followed by MTT assay. Control cells (C) were treated with vehicle DMSO (0.1% and 0.2% for U87 and T98g, respectively). *, p < 0.05; **, p < 0.01; ***, p < 0.001, compared with corresponding ev groups; +++, p < 0.001, compared with corresponding evC in the treatment phase; #, p < 0.05, ###, p < 0.001, compared with corresponding evC in the same phase.

Article Snippet: Empty vector transduced cells in U87 (evU87) (Thermo Scientific, Waltham, MA, USA, cat# RHS4750) and T98g (evT98g) (OriGene, Rockville, MD, USA, cat# TR30021) served as controls.

Techniques: Over Expression, Western Blot, Quantitation Assay, Expressing, Transgenic Assay, Plasmid Preparation, Concentration Assay, Control, Cell Culture, MTT Assay

Journal: Cells

Article Title: PDCD10 Is a Key Player in TMZ-Resistance and Tumor Cell Regrowth: Insights into Its Underlying Mechanism in Glioblastoma Cells

doi: 10.3390/cells13171442

Figure Lengend Snippet: DNA replication in response to TMZ treatment is dependent on PDCD10 expression. DNA replication was detected by EdU incorporation followed by FACS at 72 h of TMZ treatment (treatment phase) and at 3 d after TMZ-washing-out and -culturing in drug-washout media (post-treatment phase). ev/shT98g-RG and ev/oxT98g cells received 500 and 300 µM TMZ, respectively. ( A , C ) Histograms of EdU-positive (EdU+) and -negative (EdU−) cell populations in ev/shT98g-RG and ev/oxT98g cells, respectively. ( B , D ) Bar graphs of EdU+/− populations based on the corresponding histograms in ( A , C ). Knockdown of PDCD10 leads to an increase in DNA replication in both the treatment and post-treatment phases of T98g-RG cells, whereas overexpression of PDCD10 suppresses DNA replication in response to TMZ treatment. The data are representative of at least three independent experiments.

Article Snippet: Empty vector transduced cells in U87 (evU87) (Thermo Scientific, Waltham, MA, USA, cat# RHS4750) and T98g (evT98g) (OriGene, Rockville, MD, USA, cat# TR30021) served as controls.

Techniques: Expressing, Knockdown, Over Expression

Journal: Cells

Article Title: PDCD10 Is a Key Player in TMZ-Resistance and Tumor Cell Regrowth: Insights into Its Underlying Mechanism in Glioblastoma Cells

doi: 10.3390/cells13171442

Figure Lengend Snippet: Knockdown of PDCD10 in T98g-RG cells leads to deregulation of DNA damage response (DDR) genes. ev/shT98g-RG and ev/oxT98g cells received 300 µM of TMZ or vehicle (0.2% DMSO) treatment (no TMZ treatment). Cells were harvested for PCR detection of DDR genes after 72 h of TMZ treatment (treatment phase) and at 3 d after TMZ-washing-out and culturing in drug-free media (post-treatment phase). ( A ) Expression of MGMT in T98g-RG ( a ) cells and ev/oxT98g ( b ) cells in the no treatment, treatment (300 µM, 72 h), and post-treatment (3 d after washing out) phases. ( B ) Western blot ( a ) and semi-quantitation of the blots ( b ) of the MGMT protein expression in ev/shT98g-RG and ev/oxT98g cells. ( C ) Expression of DDR genes ( MSH2 , MSH6, and PMS2 ) in T98g-RG cells in the no treatment ( a ), treatment ( b ), and post-treatment phases ( c ), respectively. ( D ) Expression of DDR genes in ev/oxT98g cells in the no treatment ( a ), treatment ( b ), and post-treatment phases ( c ), respectively. *, p < 0.05; **, p < 0.01 and ***, p < 0.001, compared with corresponding ev.

Article Snippet: Empty vector transduced cells in U87 (evU87) (Thermo Scientific, Waltham, MA, USA, cat# RHS4750) and T98g (evT98g) (OriGene, Rockville, MD, USA, cat# TR30021) served as controls.

Techniques: Knockdown, Expressing, Western Blot, Quantitation Assay

Journal: Nature Communications

Article Title: Mdm2 requires Sprouty4 to regulate focal adhesion formation and metastasis independent of p53

doi: 10.1038/s41467-024-51488-2

Figure Lengend Snippet: A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.

Article Snippet: Stable cell lines were established transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene, cat.#TR30021) and using the adequate drug for cell selection.

Techniques: Transfection, Control, Stable Transfection, Expressing, shRNA, Whisker Assay

Journal: Nature Communications

Article Title: Mdm2 requires Sprouty4 to regulate focal adhesion formation and metastasis independent of p53

doi: 10.1038/s41467-024-51488-2

Figure Lengend Snippet: A – D HT1080 p53KO cells were transfected with siRNA against Mdm2 alone or both siRNA against Mdm2 and a pool of Spry4 siRNAs. A Protein levels of Mdm2, MdmX, and Spry4 after transfection with indicated siRNAs, n = 3 samples. β-actin was used as a loading control. B Quantification of wound scratch migration assay in cells treated with the indicated siRNAs as in Fig. , n = 3 samples. C Quantification of cell area after attachment to collagen-coated coverslips as in Fig. , n = 3 samples. D Immunofluorescence showing FA foci by vinculin staining (red), cell surface was outlined by phalloidin staining (green), and nuclei (blue) as detected by DAPI staining, n = 3 groups. Representative images are shown on the left, and the quantification of FA parameters is shown on the right. In ( C , D ) the graphs shown represent mean ± SD of independent experimental replicates and in each replicate all parameters were quantified in at least 20 events/condition for total of at least 60 events/condition. E , F H1299 cells were transfected with siRNA against Mdm2 alone or both siRNA against Mdm2 and a pool of Spry4 siRNAs. E Protein levels of Mdm2, MdmX, and Spry4 after transfection with indicated siRNAs. β-actin was used as a loading control, n = 3 samples. F Quantification of wound scratch migration assay comparing migration into wound scratches in cells treated with the indicated siRNAs as in Fig. , n = 3 samples. G , H HT1080 p53KO cell lines were established stably expressing a pool of shRNAs against Mdm2 alone or Mdm2 and Spry4 together. G Protein levels of Mdm2, MdmX, and Spry4 in stable cell lines. β-actin was used as a loading control, n = 3 samples. H Analysis of metastatic burden in vivo using tail-vein injection model as in Fig. H, . Representative images above and quantification below of metastatic foci in the lungs after 8 weeks of injection, n = 7 mice/group. The graphs shown represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.

Article Snippet: Stable cell lines were established transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene, cat.#TR30021) and using the adequate drug for cell selection.

Techniques: Transfection, Control, Migration, Immunofluorescence, Staining, Stable Transfection, Expressing, In Vivo, Injection

Journal: iScience

Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

doi: 10.1016/j.isci.2024.110256

Figure Lengend Snippet:

Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

Techniques: Virus, shRNA, Sequencing, Recombinant, Staining, Synthesized, Transfection, Software, RNA Sequencing Assay